home

Order Tests for Dogs

DNA Tests

Intestinal Cobalamin Malabsorption (Giant Schnauzer Type)

Description

Intestinal Cobalamin Malabsorption (Giant Schnauzer Type) affects dogs and is an inherited disease.

Dogs affected with this disease are unable to produce adequate amounts of a protein that plays a part in absorption of certain nutrients from the intestinal tract and kidneys, including the B vitamin, cobalamin.

Symptoms can begin as early as 6 to 12 weeks of age and can include anorexia, lethargy, poor weight gain, and poor muscle mass. In rare scenarios, a severe neurological dysfunction called hepatic encephalopathy may develop leading to an altered mental state, seizures, coma and death.

From a young age, dogs with this disease can have increased levels of methylmalonic acid, and an increase in certain proteins in their urine (which is a sign of cobalamin deficiency).

Decreased production of blood cells in affected dogs results in Anemia and decreased numbers of neutrophils, a type of white blood cell.

Affected dogs will require cobalamin supplementation for life. Most animals respond to treatment within a few weeks.

Although not associated with the clinical disease, affected dogs will continue to pass increased amounts of certain proteins in their urine even with cobalamin supplementation.

Recommended Breeding

Diseases

Intestinal Cobalamin Malabsorption (Giant Schnauzer Type)

$60.00

Associated Breed(s):

Click here to view Associated Breeds

Labels:

Category:

Digestive system / Gastrointestinal - Associated with the organs and structures of the digestive system

Severity:

Moderate. This disease can cause significant signs of discomfort and/or dysfunction in affected animals. It may involve relatively high treatment/management costs, and can sometimes reduce life expectancy.

Gene:

AMN

Variant Detected:

chr8:70807271-70807303 (canFam3): 33 bp deletion (del CGGGCTGCTGCTGCTGCTGCTGGCGCTGGCGGC)

Mode of Inheritance:

Autosomal Recessive

OMIA Reference:

Click to View Full OMIA Reference